labprotocol

CRISPR-Cas, a robust gene-editing technology in the era of modern cancer

Transposon Insertion within the purL Gene Induces Biofilm Depletion in Escherichia coli ATCC 25922

 

Present Escherichia coli antibiofilm remedies comprise a mixture of antibiotics generally used towards planktonic cells, resulting in therapy failure. A greater understanding of the genes concerned in biofilm formation might facilitate the event of environment friendly and particular new antibiofilm remedies.

A complete of 2578 E. coli mutants have been generated by transposon insertion, of which 536 have been analysed on this examine. After sequencing, Tn263 mutant, categorised as low biofilm-former (LF) in contrast to the wild-type (wt) pressure (ATCC 25922), confirmed an interruption within the purL gene, concerned within the de novo purine biosynthesis pathway.

To elucidate the function of purL in biofilm formation, a knockout was generated displaying lowered manufacturing of curli fibres, resulting in an impaired biofilm formation. These situations have been restored by complementation of the pressure or addition of exogenous inosine. Proteomic and transcriptional analyses have been carried out to characterise the variations brought on by purL alterations.

13 proteins have been altered in contrast to wt. The corresponding genes have been analysed by qRT-PCR not solely within the Tn263 and wt, but additionally in medical strains with totally different biofilm exercise. General, this examine means that purL is important for biofilm formation in E. coli and may be thought of as a possible antibiofilm goal.

labprotocol

Human Chemokine C-C-Motif Receptor 5 (CCR5) ELISA Kit

DLR-CCR5-Hu-96T 96T
EUR 621.00
  • Should the Human Chemokine C-C-Motif Receptor 5 (CCR5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chemokine C-C-Motif Receptor 5 (CCR5) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chemokine C-C-Motif Receptor 5 (CCR5) ELISA Kit

RD-CCR5-Hu-48Tests 48 Tests
EUR 478.00

Human Chemokine C-C-Motif Receptor 5 (CCR5) ELISA Kit

RD-CCR5-Hu-96Tests 96 Tests
EUR 662.00

Human Chemokine C-C-Motif Receptor 5 (CCR5) ELISA Kit

RDR-CCR5-Hu-48Tests 48 Tests
EUR 500.00

Human Chemokine C-C-Motif Receptor 5 (CCR5) ELISA Kit

RDR-CCR5-Hu-96Tests 96 Tests
EUR 692.00

CCR5 Antibody

AF6339 200ul
EUR 304.00
Description: CCR5 Antibody detects endogenous levels of total CCR5.

CCR5 Antibody

ABF6339 100 ug
EUR 438.00

CCR5 antibody

70R-30661 100 ug
EUR 327.00
Description: Rabbit polyclonal CCR5 antibody

CCR5 antibody

70R-30663 100 ug
EUR 327.00
Description: Rabbit polyclonal CCR5 antibody

CCR5 antibody

70R-7848 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal CCR5 antibody

CCR5 Antibody

35367-100ul 100ul
EUR 390.00

CCR5 antibody

10R-6504 100 ug
EUR 349.00
Description: Mouse monoclonal CCR5 antibody

CCR5 Antibody

24008-100ul 100ul
EUR 390.00

CCR5 antibody

20R-2781 50 ug
EUR 281.00
Description: Rabbit polyclonal CCR5 antibody

CCR5 antibody

70R-13699 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal CCR5 antibody

CCR5 antibody

70R-16245 50 ul
EUR 435.00
Description: Rabbit polyclonal CCR5 antibody

CCR5 Antibody

1-CSB-PA004844GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CCR5. Recognizes CCR5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CCR5 Antibody

1-CSB-PA004844LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR5. Recognizes CCR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:2000-1:10000, IF:1:50-1:200

Ccr5 Antibody

1-CSB-PA004844LA01MO
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccr5. Recognizes Ccr5 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

CCR5 Antibody

1-CSB-PA006993
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCR5. Recognizes CCR5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

CCR5 Antibody

1-CSB-PA006994
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCR5. Recognizes CCR5 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

CCR5 Antibody

1-CSB-PA792075
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CCR5. Recognizes CCR5 from Human. This antibody is Unconjugated. Tested in the following application: WB.IHC, ELISA;WB:1:500-2000, IHC-p:1:50-300, ELISA:1:10000-20000

CCR5 Antibody

1-CSB-PA548882
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCR5. Recognizes CCR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

CCR5 Antibody

CSB-PA572290-
EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CCR5. Recognizes CCR5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

CCR5 Antibody

CSB-PA572290-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CCR5. Recognizes CCR5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

CCR5 Antibody

1-CSB-PA265884
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCR5. Recognizes CCR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

CCR5

MO15077 100 ug
EUR 474.00

Polyclonal CCR5 Antibody

APR06222G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCR5 . This antibody is tested and proven to work in the following applications:

anti- CCR5 antibody

FNab01391 100µg
EUR 505.25
  • Immunogen: chemokine(C-C motif) receptor 5
  • Uniprot ID: P51681
  • Gene ID: 1234
  • Research Area: Neuroscience, Immunology, Signal Transduction
Description: Antibody raised against CCR5

CCR5 Polyclonal Antibody

ES8888-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against CCR5 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCR5 Polyclonal Antibody

ES8888-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against CCR5 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCR5 (pS336) Antibody

20-abx121322
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

CCR5 Polyclonal Antibody

ABP58027-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human CCR5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CCR5 from Human, Mouse, Rat. This CCR5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCR5 protein

CCR5 Polyclonal Antibody

ABP58027-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human CCR5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CCR5 from Human, Mouse, Rat. This CCR5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCR5 protein

CCR5 Polyclonal Antibody

ABP58027-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human CCR5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CCR5 from Human, Mouse, Rat. This CCR5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCR5 protein

CCR5 (pS349) Antibody

20-abx141045
  • EUR 384.00
  • EUR 606.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

CCR5 (pS349) Antibody

abx010510-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

CCR5 (pS336) Antibody

abx010511-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

CCR5 (pS349) Antibody

abx332920-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.

Anti-CCR5 Antibody

A00061-2 100ug/vial
EUR 294.00

Ccr5 Polyclonal Antibody

A58514 100 µg
EUR 570.55
Description: The best epigenetics products

CCR5 antibody (Ser336)

70R-30660 100 ug
EUR 327.00
Description: Rabbit polyclonal CCR5 antibody (Ser336)

CCR5 antibody (Ser349)

70R-30662 100 ug
EUR 327.00
Description: Rabbit polyclonal CCR5 antibody (Ser349)

CCR5(CD195) Antibody

21666-100ul 100ul
EUR 252.00

CCR5(CD195) Antibody

21666-50ul 50ul
EUR 187.00

CCR5 antibody (PE)

61R-1323 100 ug
EUR 284.00
Description: Armenian Hamster monoclonal CCR5 antibody (PE)

Anti-CCR5 antibody

PAab01391 100 ug
EUR 355.00

Anti-CCR5 Antibody

PA1016 100ug/vial
EUR 294.00

Anti-CCR5 Antibody

PA1016-1 100ug/vial
EUR 294.00

Anti-CCR5 Antibody

PA1016-2 100ug/vial
EUR 294.00

Anti-CCR5 antibody

STJ99606 200 µl
EUR 197.00
Description: Rabbit polyclonal to CCR5.

Anti-CCR5 Antibody

STJ500411 100 µg
EUR 476.00

Anti-CCR5 Antibody

STJ500415 100 µg
EUR 476.00

Recombinant human CCR5

P2049 100ug Ask for price
  • Uniprot ID: P51681
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human CCR5

CCR5 siRNA

20-abx900888
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CCR5 siRNA

20-abx910875
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CCR5 siRNA

20-abx910876
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

pCDNA3.1-CCR5

PVT12753 2 ug
EUR 703.00

anti-CCR5

YF-PA11004 50 ug
EUR 363.00
Description: Mouse polyclonal to CCR5

anti-CCR5

YF-PA11005 100 ug
EUR 403.00
Description: Rabbit polyclonal to CCR5

ML-336

C3581-10 10 mg
EUR 429.00
Description: IC50: 32, 20, and 41 nM for TC-83, V3526, and Trinidad donkey strains, respectively.ML-336 is an inhibitor for VEEV-induced cytopathic effect.

ML-336

C3581-25 25 mg
EUR 933.00
Description: IC50: 32, 20, and 41 nM for TC-83, V3526, and Trinidad donkey strains, respectively.ML-336 is an inhibitor for VEEV-induced cytopathic effect.

ML-336

C3581-5 5 mg
EUR 295.00
Description: IC50: 32, 20, and 41 nM for TC-83, V3526, and Trinidad donkey strains, respectively.ML-336 is an inhibitor for VEEV-induced cytopathic effect.

Phospho-CCR5 (Ser336) Antibody

AF3339 200ul
EUR 304.00
Description: Phospho-CCR5 (Ser336) Antibody detects endogenous levels of CCR5 only when phosphorylated at Serine 336.

CCR5(CD195) Conjugated Antibody

C21666 100ul
EUR 397.00

Phospho-CCR5(Ser349) Antibody

AF0018 200ul
EUR 304.00
Description: Phospho-CCR5(Ser349) Antibody detects endogenous levels of CCR5 only when phosphorylated at Sersine 349.

Phospho- CCR5 (Ser336) Antibody

ABF3339 100 ug
EUR 438.00

Phospho- CCR5 (Ser349) Antibody

ABF0018 100 ug
EUR 438.00

Phospho-CCR5(Ser349) Antibody

A1734-100
EUR 479.00

CCR5 (Phospho-Ser349) Antibody

11650-100ul 100ul
EUR 252.00

CCR5 (Phospho-Ser349) Antibody

11650-50ul 50ul
EUR 187.00

Phospho-CCR5 (Ser349) Antibody

CSB-PA942331-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CCR5 (Ser349). Recognizes Phospho-CCR5 (Ser349) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-CCR5 (Ser349) Antibody

CSB-PA942331-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CCR5 (Ser349). Recognizes Phospho-CCR5 (Ser349) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-CCR5 (S349) Antibody

1-CSB-PA000640
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CCR5 (S349). Recognizes Phospho-CCR5 (S349) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

CCR5 Antibody, HRP conjugated

1-CSB-PA004844LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR5. Recognizes CCR5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Ccr5 Antibody, HRP conjugated

1-CSB-PA004844LB01MO
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccr5. Recognizes Ccr5 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

CCR5 Antibody, FITC conjugated

1-CSB-PA004844LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR5. Recognizes CCR5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

Ccr5 Antibody, FITC conjugated

1-CSB-PA004844LC01MO
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccr5. Recognizes Ccr5 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

CCR5 Antibody, Biotin conjugated

1-CSB-PA004844LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR5. Recognizes CCR5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Ccr5 Antibody, Biotin conjugated

1-CSB-PA004844LD01MO
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccr5. Recognizes Ccr5 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-CCR5 (S336) Antibody

1-CSB-PA006995
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CCR5 (S336). Recognizes Phospho-CCR5 (S336) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

Anti-CCR5 Antibody (Biotin)

STJ500412 100 µg
EUR 586.00

Anti-CCR5 Antibody (FITC)

STJ500413 100 µg
EUR 586.00

Anti-CCR5 Antibody (Biotin)

STJ500418 100 µg
EUR 586.00

Anti-CCR5 Antibody (FITC)

STJ500419 100 µg
EUR 586.00

Human CCR5 ELISA Kit

EHC0243 96Tests
EUR 521.00

Human CCR5 ELISA Kit

ELA-E2055h 96 Tests
EUR 824.00

CCR5 ELISA KIT|Human

EF006159 96 Tests
EUR 689.00

Human CCR5 shRNA Plasmid

20-abx950870
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

ccr5 Recombinant Protein (Human)

RP051058 100 ug Ask for price

CCR5 Blocking Peptide

AF6339-BP 1mg
EUR 195.00

CCR5 antagonist 1

HY-100261 5mg
EUR 6261.00

CCR5 Blocking Peptide

33R-8508 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCR5 antibody, catalog no. 70R-7848

pCDNA3.1-CCR5-6

PVT16082 2 ug
EUR 325.00

Ccr5 Polyclonal Antibody, Biotin Conjugated

A58515 100 µg
EUR 570.55
Description: kits suitable for this type of research

Ccr5 Polyclonal Antibody, FITC Conjugated

A58516 100 µg
EUR 570.55
Description: fast delivery possible

Ccr5 Polyclonal Antibody, HRP Conjugated

A58517 100 µg
EUR 570.55
Description: reagents widely cited

Anti-CCR5 (Leronlimab), Humanized Antibody

A2181-100 100 µg
EUR 510.00

CCR5 ORF Vector (Human) (pORF)

ORF017020 1.0 ug DNA
EUR 95.00

Rabbit Anti Human Cd195 (Ccr5) Polyclonal Antibody

CPBT-65067RH 0.1 mg
EUR 710.00

CCR5 (Phospho-Ser349) Polyclonal Conjugated Antibody

C11650 100ul
EUR 397.00

CCR5 Cell ELISA Kit

abx595100-96tests 96 tests
EUR 637.00
  • Shipped within 1-2 weeks.

Rat CCR5 shRNA Plasmid

20-abx987379
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Goat CCR5 ELISA Kit

EGTC0243 96Tests
EUR 521.00

Canine CCR5 ELISA Kit

ECC0243 96Tests
EUR 521.00

Chicken CCR5 ELISA Kit

ECKC0243 96Tests
EUR 521.00

Bovine CCR5 ELISA Kit

EBC0243 96Tests
EUR 521.00

Anserini CCR5 ELISA Kit

EAC0243 96Tests
EUR 521.00

Porcine CCR5 ELISA Kit

EPC0243 96Tests
EUR 521.00

Rat CCR5 ELISA Kit

ERC0243 96Tests
EUR 521.00

Rabbit CCR5 ELISA Kit

ERTC0243 96Tests
EUR 521.00

Sheep CCR5 ELISA Kit

ESC0243 96Tests
EUR 521.00

Mouse CCR5 ELISA Kit

EMC0243 96Tests
EUR 521.00

Monkey CCR5 ELISA Kit

EMKC0243 96Tests
EUR 521.00

CCR5 (pS336) Blocking Peptide

20-abx161322
  • EUR 314.00
  • EUR 509.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CCR5 (pS349) Blocking Peptide

20-abx061743
  • EUR 300.00
  • EUR 495.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Mouse CCR5 shRNA Plasmid

20-abx969720
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

ccr5 Recombinant Protein (Rat)

RP193787 100 ug Ask for price

ccr5 Recombinant Protein (Mouse)

RP122252 100 ug Ask for price

ITLN1

E541-336 100ug
EUR 343.00

scAAV6-GFP Control Virus

AAV-336 50 ?L
EUR 1018.00
Description: Self-complementary GFP control virus of AAV serotype 6.

rno-miR-336 Primers

MP-r00013 150 ul / 10 uM
EUR 176.00

CCR5 sgRNA CRISPR Lentivector set (Human)

K0395101 3 x 1.0 ug
EUR 339.00

Rabbit Anti-Human MAPKAPK2 (aa 332-336) Polyclonal Antibody

CPB-1184RH 100 ul
EUR 460.00

Rabbit Anti-Human RAF1 Polyclonal Antibody (aa 336~340)

CPB-1903RH 101ul
EUR 460.00

CCR5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0395102 1.0 ug DNA
EUR 154.00

CCR5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0395103 1.0 ug DNA
EUR 154.00

CCR5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0395104 1.0 ug DNA
EUR 154.00

ccr5 Protein Vector (Human) (pPB-C-His)

PV068077 500 ng
EUR 552.00

ccr5 Protein Vector (Human) (pPB-N-His)

PV068078 500 ng
EUR 552.00

ccr5 Protein Vector (Human) (pPM-C-HA)

PV068079 500 ng
EUR 329.00

ccr5 Protein Vector (Human) (pPM-C-His)

PV068080 500 ng
EUR 552.00

Phospho-CCR5 (Ser336) Blocking Peptide

AF3339-BP 1mg
EUR 195.00

Phospho-CCR5(Ser349) Blocking Peptide

AF0018-BP 1mg
EUR 195.00

Guinea Pig CCR5 ELISA Kit

EGC0243 96Tests
EUR 521.00

Ccr5 ORF Vector (Mouse) (pORF)

ORF040752 1.0 ug DNA
EUR 95.00

 

Characterizing patient-oncologist communication in genomic tumor testing: The 21-gene recurrence rating as an exemplar

 

Goal: Ladies with early-stage, ER + breast most cancers are suggest to obtain genomic profiling exams, reminiscent of the 21-gene Recurrence Rating (RS) take a look at, to information therapy choices. We examined test- and treatment-related info mentioned and the associations between RS classes and elements of communication throughout patient-oncologist medical encounters.

 

Strategies: As half of a bigger trial, medical encounters (N = 46) have been audiorecorded and coded for 1) RS- and treatment-related info, 2) shared resolution making, 3) affected person energetic participation, and 4) oncologist patient-centered communication. We examined variations by RS class utilizing blended fashions, adjusting for nesting inside oncologist.

 

Outcomes: Sufferers with a excessive RS have been extra prone to obtain a chemotherapy suggestion (p < .01), hear concerning the dangers/unintended effects of chemotherapy (p < .01), and provide their preferences (p = .02) than these with intermediate or low RS. Parts of shared resolution making elevated with RS. Oncologist patient-centered communication (M = 4.09/5, SD = .25) and affected person energetic participation (M = 3.5/4, SD = 1.0) have been excessive throughout RS.

 

Conclusion: Findings counsel that illness severity, quite than medical uncertainty, impression therapy suggestions and shared resolution making.

 

Observe implications: Oncologists modify test- and treatment-related info and shared resolution making by illness severity. This info supplies a framework to tell resolution making in complicated most cancers and genomics settings.

 

CRISPR-Cas, a sturdy gene-editing know-how within the period of contemporary most cancers immunotherapy

 

Most cancers immunotherapy has been emerged as a promising technique for therapy of a broad spectrum of malignancies starting from hematological to strong tumors. One of many principal approaches of most cancers immunotherapy is switch of pure or engineered tumor-specific T-cells into sufferers,

a so referred to as “adoptive cell switch”, or ACT, course of. Building of allogeneic T-cells relies on the employment of a gene-editing software to change donor-extracted T-cells and put together them to particularly act towards tumor cells with enhanced perform and sturdiness and least side-effects. On this context, CRISPR know-how can be utilized to supply common T-cells, geared up with recombinant T cell receptor (TCR) or chimeric antigen receptor (CAR), by means of multiplex genome engineering utilizing Cas nucleases.

The sturdy potential of CRISPR-Cas in making ready the constructing blocks of ACT immunotherapy has broaden the appliance of such therapies and a few of them have gotten FDA approvals. Right here, now we have collected the final investigations within the discipline of immuno-oncology performed in partnership with CRISPR know-how. As well as, research which have addressed the challenges within the path of CRISPR-mediated most cancers immunotherapy, in addition to pre-treatment purposes of CRISPR-Cas have been talked about intimately.

 

CBLL1 Antibody

DF12576 200ul
EUR 304.00
Description: CBLL1 Antibody detects endogenous levels of CBLL1.

CBLL1 antibody

70R-8000 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal CBLL1 antibody

CBLL1 antibody

70R-8378 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal CBLL1 antibody

CBLL1 Polyclonal Antibody

28768-100ul 100ul
EUR 252.00

CBLL1 Polyclonal Antibody

28768-50ul 50ul
EUR 187.00

anti- CBLL1 antibody

FNab01320 100µg
EUR 548.75
  • Immunogen: Cas-Br-M(murine) ecotropic retroviral transforming sequence-like 1
  • Uniprot ID: Q75N03
  • Gene ID: 79872
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against CBLL1

Anti-CBLL1 antibody

PAab01320 100 ug
EUR 386.00

Anti-CBLL1 antibody

STJ117131 100 µl
EUR 277.00
Description: This gene encodes an E3 ubiquitin-ligase for the E-cadherin complex and mediates its ubiquitination, endocytosis, and degradation in the lysosomes. The encoded protein contains a RING-finger domain and is also thought to have a role in control of cell proliferation. A related pseudogene has been identified on chromosome X. Alternative splicing results in a non-coding transcript variant.

CBLL1 siRNA

20-abx910399
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CBLL1 siRNA

20-abx910400
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti-CBLL1

YF-PA26621 50 ul
EUR 334.00
Description: Mouse polyclonal to CBLL1

CBLL1 Polyclonal Conjugated Antibody

C28768 100ul
EUR 397.00

CBLL1 Blocking Peptide

33R-5838 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CBLL1 antibody, catalog no. 70R-8000

CBLL1 Blocking Peptide

33R-5839 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CBLL1 antibody, catalog no. 70R-8378

CBLL1 Blocking Peptide

33R-7089 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CBLL1 antibody, catalog no. 20R-1225

CBLL1 Blocking Peptide

DF12576-BP 1mg
EUR 195.00

CBLL1 cloning plasmid

CSB-CL755210HU-10ug 10ug
EUR 523.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1476
  • Sequence: atggatcacactgacaatgagttacaaggcactaatagttctggatccttgggtggtcttgatgttcgcagacgaattcctataaagctcatctccaaacaagcaaacaaagcgaaacctgcaccgcgaactcaaagaactataaacaggatgcctgcaaaggctccacctggtg
  • Show more
Description: A cloning plasmid for the CBLL1 gene.

CBLL1 Rabbit pAb

A14932-100ul 100 ul
EUR 308.00

CBLL1 Rabbit pAb

A14932-200ul 200 ul
EUR 459.00

CBLL1 Rabbit pAb

A14932-20ul 20 ul
EUR 183.00

CBLL1 Rabbit pAb

A14932-50ul 50 ul
EUR 223.00

Anti-CBLL1 (4C2)

YF-MA19375 100 ug
EUR 363.00
Description: Mouse monoclonal to CBLL1

Anti-CBLL1 (3B12)

YF-MA19376 100 ug
EUR 363.00
Description: Mouse monoclonal to CBLL1

CBLL1 ELISA KIT|Human

EF008414 96 Tests
EUR 689.00

Mouse CBLL1 shRNA Plasmid

20-abx979665
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human CBLL1 shRNA Plasmid

20-abx962629
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

CBLL1 Recombinant Protein (Human)

RP037747 100 ug Ask for price

CBLL1 Recombinant Protein (Rat)

RP193286 100 ug Ask for price

CBLL1 Recombinant Protein (Mouse)

RP121400 100 ug Ask for price

CBLL1 Recombinant Protein (Mouse)

RP121403 100 ug Ask for price

CBLL1 Recombinant Protein (Mouse)

RP121406 100 ug Ask for price

Polyclonal CBLL1 antibody - N-terminal region

APR00636G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CBLL1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal CBLL1 antibody - N-terminal region

APR00763G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CBLL1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal CBLL1 antibody - C-terminal region

APR00764G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CBLL1 - C-terminal region. This antibody is tested and proven to work in the following applications:

E3 Ubiquitin-Protein Ligase Hakai (CBLL1) Antibody

20-abx111412
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase Hakai (CBLL1) Antibody

abx231320-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Monoclonal CBLL1 Antibody (monoclonal) (M01), Clone: 4C2

AMM03326G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human CBLL1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4C2. This antibody is applicable in WB and IF

Cbll1 ORF Vector (Rat) (pORF)

ORF064430 1.0 ug DNA
EUR 506.00

CBLL1 ORF Vector (Human) (pORF)

ORF012583 1.0 ug DNA
EUR 354.00

Cbll1 ORF Vector (Mouse) (pORF)

ORF040468 1.0 ug DNA
EUR 1572.00

Cbll1 ORF Vector (Mouse) (pORF)

ORF040469 1.0 ug DNA
EUR 506.00

Cbll1 ORF Vector (Mouse) (pORF)

ORF040470 1.0 ug DNA
EUR 506.00

CBLL1 sgRNA CRISPR Lentivector set (Human)

K0368901 3 x 1.0 ug
EUR 339.00

Cbll1 sgRNA CRISPR Lentivector set (Rat)

K6165601 3 x 1.0 ug
EUR 339.00

Cbll1 sgRNA CRISPR Lentivector set (Mouse)

K3495701 3 x 1.0 ug
EUR 339.00

CBLL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0368902 1.0 ug DNA
EUR 154.00

CBLL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0368903 1.0 ug DNA
EUR 154.00

CBLL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0368904 1.0 ug DNA
EUR 154.00

Cbll1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6165602 1.0 ug DNA
EUR 154.00

Cbll1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6165603 1.0 ug DNA
EUR 154.00

Cbll1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6165604 1.0 ug DNA
EUR 154.00

Cbll1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3495702 1.0 ug DNA
EUR 154.00

Cbll1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3495703 1.0 ug DNA
EUR 154.00

Cbll1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3495704 1.0 ug DNA
EUR 154.00

CBLL1 Protein Vector (Mouse) (pPB-C-His)

PV161870 500 ng
EUR 2286.00

CBLL1 Protein Vector (Mouse) (pPB-N-His)

PV161871 500 ng
EUR 2286.00

CBLL1 Protein Vector (Mouse) (pPM-C-HA)

PV161872 500 ng
EUR 2286.00

CBLL1 Protein Vector (Mouse) (pPM-C-His)

PV161873 500 ng
EUR 2286.00

CBLL1 Protein Vector (Mouse) (pPB-C-His)

PV161874 500 ng
EUR 603.00

CBLL1 Protein Vector (Mouse) (pPB-N-His)

PV161875 500 ng
EUR 603.00

CBLL1 Protein Vector (Mouse) (pPM-C-HA)

PV161876 500 ng
EUR 603.00

CBLL1 Protein Vector (Mouse) (pPM-C-His)

PV161877 500 ng
EUR 603.00

CBLL1 Protein Vector (Mouse) (pPB-C-His)

PV161878 500 ng
EUR 1065.00

CBLL1 Protein Vector (Mouse) (pPB-N-His)

PV161879 500 ng
EUR 1065.00

CBLL1 Protein Vector (Mouse) (pPM-C-HA)

PV161880 500 ng
EUR 1065.00

CBLL1 Protein Vector (Mouse) (pPM-C-His)

PV161881 500 ng
EUR 1065.00

CBLL1 Protein Vector (Rat) (pPB-C-His)

PV257718 500 ng
EUR 603.00

CBLL1 Protein Vector (Rat) (pPB-N-His)

PV257719 500 ng
EUR 603.00

CBLL1 Protein Vector (Rat) (pPM-C-HA)

PV257720 500 ng
EUR 603.00

CBLL1 Protein Vector (Rat) (pPM-C-His)

PV257721 500 ng
EUR 603.00

CBLL1 Protein Vector (Human) (pPB-C-His)

PV050329 500 ng
EUR 481.00

CBLL1 Protein Vector (Human) (pPB-N-His)

PV050330 500 ng
EUR 481.00

CBLL1 Protein Vector (Human) (pPM-C-HA)

PV050331 500 ng
EUR 481.00

CBLL1 Protein Vector (Human) (pPM-C-His)

PV050332 500 ng
EUR 481.00

Cbll1 3'UTR GFP Stable Cell Line

TU153189 1.0 ml Ask for price

Cbll1 3'UTR Luciferase Stable Cell Line

TU103189 1.0 ml Ask for price

Cbll1 3'UTR Luciferase Stable Cell Line

TU201709 1.0 ml Ask for price

Cbll1 3'UTR GFP Stable Cell Line

TU251709 1.0 ml Ask for price

CBLL1 3'UTR GFP Stable Cell Line

TU053540 1.0 ml
EUR 1394.00

CBLL1 3'UTR Luciferase Stable Cell Line

TU003540 1.0 ml
EUR 1394.00

Mouse E3 ubiquitin- protein ligase Hakai, Cbll1 ELISA KIT

ELI-14188m 96 Tests
EUR 865.00

Chicken E3 ubiquitin- protein ligase Hakai, CBLL1 ELISA KIT

ELI-30863c 96 Tests
EUR 928.00

Human E3 ubiquitin- protein ligase Hakai, CBLL1 ELISA KIT

ELI-08497h 96 Tests
EUR 824.00

Human E3 Ubiquitin-Protein Ligase Hakai (CBLL1) ELISA Kit

20-abx386310
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 0
  • 1
  • 2
  • Shipped within 5-12 working days.

Mouse E3 Ubiquitin-Protein Ligase Hakai (CBLL1) ELISA Kit

abx388786-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Cbll1 ELISA Kit| Mouse E3 ubiquitin-protein ligase Hakai ELISA

EF014411 96 Tests
EUR 689.00

CBLL1 ELISA Kit| chicken E3 ubiquitin-protein ligase Hakai ELIS

EF012235 96 Tests
EUR 689.00

CBLL1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0368905 3 x 1.0 ug
EUR 376.00

Cbll1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6165605 3 x 1.0 ug
EUR 376.00

Cbll1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3495705 3 x 1.0 ug
EUR 376.00

CBLL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0368906 1.0 ug DNA
EUR 167.00

CBLL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0368907 1.0 ug DNA
EUR 167.00

CBLL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0368908 1.0 ug DNA
EUR 167.00

Cbll1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6165606 1.0 ug DNA
EUR 167.00

Cbll1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6165607 1.0 ug DNA
EUR 167.00

Cbll1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6165608 1.0 ug DNA
EUR 167.00

Cbll1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3495706 1.0 ug DNA
EUR 167.00

Cbll1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3495707 1.0 ug DNA
EUR 167.00

Cbll1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3495708 1.0 ug DNA
EUR 167.00

H2B Antibody Antibody

AF4659 200ul
EUR 376.00
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438.00

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438.00

Ly1 Antibody Reactive (LYAR) Antibody

20-abx008109
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

20-abx004855
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx123734
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx014333
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319900
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319901
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319913
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx234901-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx324434
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx311665
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx230204-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277.00
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277.00

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277.00

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277.00

Leave a Reply

Your email address will not be published. Required fields are marked *